Review



blunt end cloning vector pjet1 2  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Addgene inc blunt end cloning vector pjet1 2
    Blunt End Cloning Vector Pjet1 2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+1+plasmid/NHR1-Flag+pcDNA3%2E1+(Plasmid+%2317315)/pmc12804166-56-8-12
    Average 94 stars, based on 2 article reviews
    blunt end cloning vector pjet1 2 - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Generated:

    Article Title: Treatment for Wolfram syndrome
    Article Snippet: .. WFS1-OE cells were generated by transfecting WFS1-KO clone #1 cells with a pcDNA3.1 plasmid carrying the full-length WFS1 sequence (Addgene, #13011) using Lipofectamine 2000 (Thermo Fisher), followed by 4 weeks of antibiotic selection with 2 mg/mL G418 (AmericanBio). ..

    Article Title: Targeted and efficient AAV therapy for neuroblastoma via direct capsid-antibody coupling
    Article Snippet: .. The SpyCatcher peptide sequence, fused to the scFv-anti-GD2 (a kind gift from M. Brenner), was synthesized by Azenta Genewiz and subcloned into pcDNA3.1 plasmid (Addgene) with a V5 tag inserted between the two peptides and a His-tag added at the C-terminus of the construct. scAAV-CMV vectors carrying the ZsGreen, Luciferase, and HSV-TK transgenes were generated by amplifying the respective coding sequences (CDS) and cloning them into the scAAV-GFP backbone (Addgene #32396) using BamHI and NotI restriction sites. .. Finally, a bicistronic lentiviral vector (Luciferase-IRES-Puro) was generated by amplifying the Luciferase CDS and cloning it into the Lv-Ef1a-IRES-Puro vector (Addgene #85132) using BamHI and EcoRI restriction sites.

    Plasmid Preparation:

    Article Title: Treatment for Wolfram syndrome
    Article Snippet: .. WFS1-OE cells were generated by transfecting WFS1-KO clone #1 cells with a pcDNA3.1 plasmid carrying the full-length WFS1 sequence (Addgene, #13011) using Lipofectamine 2000 (Thermo Fisher), followed by 4 weeks of antibiotic selection with 2 mg/mL G418 (AmericanBio). ..

    Article Title: mTORC1-dependent suppression of autophagic activity in somatic cell nuclear transfer mouse embryos
    Article Snippet: .. Briefly, the pcDNA3.1 plasmid carrying the full-length mouse Kdm4d sequence (61553, Addgene, USA) was linearized by XbaI, and it was used as a template for in vitro transcription using mMESSAGE mMACHINE T7 ULTRA Transcription kits (AM1345, Thermo Fisher Scientific). ..

    Article Title: Targeted and efficient AAV therapy for neuroblastoma via direct capsid-antibody coupling
    Article Snippet: .. The SpyCatcher peptide sequence, fused to the scFv-anti-GD2 (a kind gift from M. Brenner), was synthesized by Azenta Genewiz and subcloned into pcDNA3.1 plasmid (Addgene) with a V5 tag inserted between the two peptides and a His-tag added at the C-terminus of the construct. scAAV-CMV vectors carrying the ZsGreen, Luciferase, and HSV-TK transgenes were generated by amplifying the respective coding sequences (CDS) and cloning them into the scAAV-GFP backbone (Addgene #32396) using BamHI and NotI restriction sites. .. Finally, a bicistronic lentiviral vector (Luciferase-IRES-Puro) was generated by amplifying the Luciferase CDS and cloning it into the Lv-Ef1a-IRES-Puro vector (Addgene #85132) using BamHI and EcoRI restriction sites.

    Article Title: ASS1 inhibits liver cancer by promoting CAD ubiquitination and reversing the urea cycle and pyrimidine synthesis imbalance
    Article Snippet: The antibodies used are as follows: ASS1 (1:1000/1:3000, Cat. #: 70720, Cell Signaling Technology), CAD (1:500, Cat. #: 93925, Cell Signaling Technology), GAPDH (1:5000, Cat. #: ABP50163, Abbkibe), HA (1:1000, Cat. #: AE036, Abclonal), Flag (1:1000, Cat. #: AE005, Abclonal), Ub (1:1000, Cat. #: 10201-2-AP, Proteintech), STUB1 (1:1000, Cat. #: 55430-1-AP, Proteintech), and Goat Anti-Rabbit IgG (1:10000, Cat. #: A21020, Abbkibe). .. The Flag-ASS1 was inserted into the pcDNA3.1 plasmid (Addgene). ..

    Article Title: ALPP Induces Epithelial-Mesenchymal Transition by Activating the Wnt/β-Catenin Signaling Pathway in Colorectal Cancer Cells
    Article Snippet: .. The pcDNA3.1 (+) plasmid was obtained from addgene Company, and the pcDNA3.1 (+) -ALP primer sequence is as follows: pcDNA3.1(+)-ALPP-F:TACCGAGCTCGGATCCATGCTGGGGCCCTGCATGCTG; pcDNA3.1(+)-ALPP -R:GATATCTGCAGAATTCTCAGGGAGCAGTGGCCGTC. ..

    Article Title: ASS1 inhibits liver cancer by promoting CAD ubiquitination and reversing the urea cycle and pyrimidine synthesis imbalance
    Article Snippet: The antibodies used are as follows: ASS1 (1:1000/1:3000, Cat. #: 70720, Cell Signaling Technology), CAD (1:500, Cat. #: 93925, Cell Signaling Technology), GAPDH (1:5000, Cat. #: ABP50163 , Abbkibe), HA (1:1000, Cat. #: AE036, Abclonal), Flag (1:1000, Cat. #: AE005, Abclonal), Ub (1:1000, Cat. #: 10201-2-AP, Proteintech), STUB1 (1:1000, Cat. #: 55430-1-AP, Proteintech), and Goat Anti-Rabbit IgG (1:10000, Cat. #: A21020, Abbkibe). .. The Flag-ASS1 was inserted into the pcDNA3.1 plasmid (Addgene). ..

    Article Title: ALPP Induces Epithelial-Mesenchymal Transition by Activating the Wnt/β-Catenin Signaling Pathway in Colorectal Cancer Cells
    Article Snippet: .. The pcDNA3.1 (+) plasmid was obtained from addgene Company, and the pcDNA3.1 (+) -ALP primer sequence is as follows: pcDNA3.1(+)-ALPP-F:TACCGAGCTCGGATCCATGCTGGGGCCCTGCATGCTG; pcDNA3.1(+)-ALPP-R:GATATCTGCAGAATTCTCAGGGAGCAGTGGCCGTC. ..

    Article Title: TAS-seq enables subcellular single-stranded adenosine profiling by signal peptide-assisted adenosine deamination
    Article Snippet: E. coli BL21(DE3) (New England Biolabs, Cat# C2527I) was cultured in an incubator shaker at 37°C and 220 rpm in an LB medium. .. The DNA fragment encoding TadA-8e was amplified from the Plasmid ABE8e plasmid (Addgene, Cat# 38489) and cloned into a modified pCDNA3.1 plasmid (Addgene, Cat# V790-20), wherein the CMV promoter had been replaced with an EF-1α promoter. ..

    Sequencing:

    Article Title: Treatment for Wolfram syndrome
    Article Snippet: .. WFS1-OE cells were generated by transfecting WFS1-KO clone #1 cells with a pcDNA3.1 plasmid carrying the full-length WFS1 sequence (Addgene, #13011) using Lipofectamine 2000 (Thermo Fisher), followed by 4 weeks of antibiotic selection with 2 mg/mL G418 (AmericanBio). ..

    Article Title: mTORC1-dependent suppression of autophagic activity in somatic cell nuclear transfer mouse embryos
    Article Snippet: .. Briefly, the pcDNA3.1 plasmid carrying the full-length mouse Kdm4d sequence (61553, Addgene, USA) was linearized by XbaI, and it was used as a template for in vitro transcription using mMESSAGE mMACHINE T7 ULTRA Transcription kits (AM1345, Thermo Fisher Scientific). ..

    Article Title: Targeted and efficient AAV therapy for neuroblastoma via direct capsid-antibody coupling
    Article Snippet: .. The SpyCatcher peptide sequence, fused to the scFv-anti-GD2 (a kind gift from M. Brenner), was synthesized by Azenta Genewiz and subcloned into pcDNA3.1 plasmid (Addgene) with a V5 tag inserted between the two peptides and a His-tag added at the C-terminus of the construct. scAAV-CMV vectors carrying the ZsGreen, Luciferase, and HSV-TK transgenes were generated by amplifying the respective coding sequences (CDS) and cloning them into the scAAV-GFP backbone (Addgene #32396) using BamHI and NotI restriction sites. .. Finally, a bicistronic lentiviral vector (Luciferase-IRES-Puro) was generated by amplifying the Luciferase CDS and cloning it into the Lv-Ef1a-IRES-Puro vector (Addgene #85132) using BamHI and EcoRI restriction sites.

    Article Title: ALPP Induces Epithelial-Mesenchymal Transition by Activating the Wnt/β-Catenin Signaling Pathway in Colorectal Cancer Cells
    Article Snippet: .. The pcDNA3.1 (+) plasmid was obtained from addgene Company, and the pcDNA3.1 (+) -ALP primer sequence is as follows: pcDNA3.1(+)-ALPP-F:TACCGAGCTCGGATCCATGCTGGGGCCCTGCATGCTG; pcDNA3.1(+)-ALPP -R:GATATCTGCAGAATTCTCAGGGAGCAGTGGCCGTC. ..

    Article Title: ALPP Induces Epithelial-Mesenchymal Transition by Activating the Wnt/β-Catenin Signaling Pathway in Colorectal Cancer Cells
    Article Snippet: .. The pcDNA3.1 (+) plasmid was obtained from addgene Company, and the pcDNA3.1 (+) -ALP primer sequence is as follows: pcDNA3.1(+)-ALPP-F:TACCGAGCTCGGATCCATGCTGGGGCCCTGCATGCTG; pcDNA3.1(+)-ALPP-R:GATATCTGCAGAATTCTCAGGGAGCAGTGGCCGTC. ..

    Selection:

    Article Title: Treatment for Wolfram syndrome
    Article Snippet: .. WFS1-OE cells were generated by transfecting WFS1-KO clone #1 cells with a pcDNA3.1 plasmid carrying the full-length WFS1 sequence (Addgene, #13011) using Lipofectamine 2000 (Thermo Fisher), followed by 4 weeks of antibiotic selection with 2 mg/mL G418 (AmericanBio). ..

    In Vitro:

    Article Title: mTORC1-dependent suppression of autophagic activity in somatic cell nuclear transfer mouse embryos
    Article Snippet: .. Briefly, the pcDNA3.1 plasmid carrying the full-length mouse Kdm4d sequence (61553, Addgene, USA) was linearized by XbaI, and it was used as a template for in vitro transcription using mMESSAGE mMACHINE T7 ULTRA Transcription kits (AM1345, Thermo Fisher Scientific). ..

    Synthesized:

    Article Title: Targeted and efficient AAV therapy for neuroblastoma via direct capsid-antibody coupling
    Article Snippet: .. The SpyCatcher peptide sequence, fused to the scFv-anti-GD2 (a kind gift from M. Brenner), was synthesized by Azenta Genewiz and subcloned into pcDNA3.1 plasmid (Addgene) with a V5 tag inserted between the two peptides and a His-tag added at the C-terminus of the construct. scAAV-CMV vectors carrying the ZsGreen, Luciferase, and HSV-TK transgenes were generated by amplifying the respective coding sequences (CDS) and cloning them into the scAAV-GFP backbone (Addgene #32396) using BamHI and NotI restriction sites. .. Finally, a bicistronic lentiviral vector (Luciferase-IRES-Puro) was generated by amplifying the Luciferase CDS and cloning it into the Lv-Ef1a-IRES-Puro vector (Addgene #85132) using BamHI and EcoRI restriction sites.

    Construct:

    Article Title: Targeted and efficient AAV therapy for neuroblastoma via direct capsid-antibody coupling
    Article Snippet: .. The SpyCatcher peptide sequence, fused to the scFv-anti-GD2 (a kind gift from M. Brenner), was synthesized by Azenta Genewiz and subcloned into pcDNA3.1 plasmid (Addgene) with a V5 tag inserted between the two peptides and a His-tag added at the C-terminus of the construct. scAAV-CMV vectors carrying the ZsGreen, Luciferase, and HSV-TK transgenes were generated by amplifying the respective coding sequences (CDS) and cloning them into the scAAV-GFP backbone (Addgene #32396) using BamHI and NotI restriction sites. .. Finally, a bicistronic lentiviral vector (Luciferase-IRES-Puro) was generated by amplifying the Luciferase CDS and cloning it into the Lv-Ef1a-IRES-Puro vector (Addgene #85132) using BamHI and EcoRI restriction sites.

    Luciferase:

    Article Title: Targeted and efficient AAV therapy for neuroblastoma via direct capsid-antibody coupling
    Article Snippet: .. The SpyCatcher peptide sequence, fused to the scFv-anti-GD2 (a kind gift from M. Brenner), was synthesized by Azenta Genewiz and subcloned into pcDNA3.1 plasmid (Addgene) with a V5 tag inserted between the two peptides and a His-tag added at the C-terminus of the construct. scAAV-CMV vectors carrying the ZsGreen, Luciferase, and HSV-TK transgenes were generated by amplifying the respective coding sequences (CDS) and cloning them into the scAAV-GFP backbone (Addgene #32396) using BamHI and NotI restriction sites. .. Finally, a bicistronic lentiviral vector (Luciferase-IRES-Puro) was generated by amplifying the Luciferase CDS and cloning it into the Lv-Ef1a-IRES-Puro vector (Addgene #85132) using BamHI and EcoRI restriction sites.

    Cloning:

    Article Title: Targeted and efficient AAV therapy for neuroblastoma via direct capsid-antibody coupling
    Article Snippet: .. The SpyCatcher peptide sequence, fused to the scFv-anti-GD2 (a kind gift from M. Brenner), was synthesized by Azenta Genewiz and subcloned into pcDNA3.1 plasmid (Addgene) with a V5 tag inserted between the two peptides and a His-tag added at the C-terminus of the construct. scAAV-CMV vectors carrying the ZsGreen, Luciferase, and HSV-TK transgenes were generated by amplifying the respective coding sequences (CDS) and cloning them into the scAAV-GFP backbone (Addgene #32396) using BamHI and NotI restriction sites. .. Finally, a bicistronic lentiviral vector (Luciferase-IRES-Puro) was generated by amplifying the Luciferase CDS and cloning it into the Lv-Ef1a-IRES-Puro vector (Addgene #85132) using BamHI and EcoRI restriction sites.

    Amplification:

    Article Title: TAS-seq enables subcellular single-stranded adenosine profiling by signal peptide-assisted adenosine deamination
    Article Snippet: E. coli BL21(DE3) (New England Biolabs, Cat# C2527I) was cultured in an incubator shaker at 37°C and 220 rpm in an LB medium. .. The DNA fragment encoding TadA-8e was amplified from the Plasmid ABE8e plasmid (Addgene, Cat# 38489) and cloned into a modified pCDNA3.1 plasmid (Addgene, Cat# V790-20), wherein the CMV promoter had been replaced with an EF-1α promoter. ..

    Clone Assay:

    Article Title: TAS-seq enables subcellular single-stranded adenosine profiling by signal peptide-assisted adenosine deamination
    Article Snippet: E. coli BL21(DE3) (New England Biolabs, Cat# C2527I) was cultured in an incubator shaker at 37°C and 220 rpm in an LB medium. .. The DNA fragment encoding TadA-8e was amplified from the Plasmid ABE8e plasmid (Addgene, Cat# 38489) and cloned into a modified pCDNA3.1 plasmid (Addgene, Cat# V790-20), wherein the CMV promoter had been replaced with an EF-1α promoter. ..

    Modification:

    Article Title: TAS-seq enables subcellular single-stranded adenosine profiling by signal peptide-assisted adenosine deamination
    Article Snippet: E. coli BL21(DE3) (New England Biolabs, Cat# C2527I) was cultured in an incubator shaker at 37°C and 220 rpm in an LB medium. .. The DNA fragment encoding TadA-8e was amplified from the Plasmid ABE8e plasmid (Addgene, Cat# 38489) and cloned into a modified pCDNA3.1 plasmid (Addgene, Cat# V790-20), wherein the CMV promoter had been replaced with an EF-1α promoter. ..



    Similar Products

    86
    Genechem pcdna3 1 slc16a9 overexpression plasmid
    Pcdna3 1 Slc16a9 Overexpression Plasmid, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+1+plasmid/1+mouse+pcdna3+plasmid+sting/pm42271166-59-16-40
    Average 86 stars, based on 1 article reviews
    pcdna3 1 slc16a9 overexpression plasmid - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Genechem pcdna3 1 relb 85 overexpression plasmid
    Pcdna3 1 Relb 85 Overexpression Plasmid, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+1+plasmid/1+mouse+pcdna3+plasmid+sting/pm42263883-43-1-19
    Average 86 stars, based on 1 article reviews
    pcdna3 1 relb 85 overexpression plasmid - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    94
    Addgene inc blunt end cloning vector pjet1 2
    Blunt End Cloning Vector Pjet1 2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+1+plasmid/NHR1-Flag+pcDNA3%2E1+(Plasmid+%2317315)/pmc12804166-56-8-12
    Average 94 stars, based on 1 article reviews
    blunt end cloning vector pjet1 2 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    86
    Genechem itgb1 pcdna3 1 plasmid
    Itgb1 Pcdna3 1 Plasmid, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+1+plasmid/1+mouse+pcdna3+plasmid+sting/10__1016_slash_j__apsb__2026__06__005-135-1-9
    Average 86 stars, based on 1 article reviews
    itgb1 pcdna3 1 plasmid - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Servicebio Inc plasmid pcdna3 1 caspase
    Plasmid Pcdna3 1 Caspase, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+1+plasmid/1+8+caspase+pcdna3+plasmid/pmc13010924-92-1-7
    Average 86 stars, based on 1 article reviews
    plasmid pcdna3 1 caspase - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Genechem pcdna3 1 wwc2 overexpression plasmid
    Pcdna3 1 Wwc2 Overexpression Plasmid, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+1+plasmid/1+mouse+pcdna3+plasmid+sting/pm42122145-55-1-11
    Average 86 stars, based on 1 article reviews
    pcdna3 1 wwc2 overexpression plasmid - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Sangon Biotech overexpression plasmid pcdna3 1 dnmt1
    Overexpression Plasmid Pcdna3 1 Dnmt1, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+1+plasmid/cas9+plasmid+puromycin+recombinant+sgrna/pmc13122296-90-15-23
    Average 86 stars, based on 1 article reviews
    overexpression plasmid pcdna3 1 dnmt1 - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    91
    Addgene inc cloning pcdna hisc mtaz addgene
    Cloning Pcdna Hisc Mtaz Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+1+plasmid/pcDNA3%2E1%2FHisC-mTAZ+(Plasmid+%2331793)/pm41928626-296-163-165
    Average 91 stars, based on 1 article reviews
    cloning pcdna hisc mtaz addgene - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    86
    Obio Technology Corp Ltd pcdna3 1 ets1 3xflag mcherry plasmid
    Pcdna3 1 Ets1 3xflag Mcherry Plasmid, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+1+plasmid/3xflag+gad67+mcherry+paav+wpre/pm41932324-452-1-10
    Average 86 stars, based on 1 article reviews
    pcdna3 1 ets1 3xflag mcherry plasmid - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    91
    Addgene inc pt3 myr akt addgene
    Pt3 Myr Akt Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+1+plasmid/pcDNA3%2E1%2FHisC-mTAZ+(Plasmid+%2331793)/pm41928626-296-167-168
    Average 91 stars, based on 1 article reviews
    pt3 myr akt addgene - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    Image Search Results